View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5654_2D_low_67 (Length: 423)
Name: NF5654_2D_low_67
Description: NF5654_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5654_2D_low_67 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 366; Significance: 0; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 366; E-Value: 0
Query Start/End: Original strand, 2 - 379
Target Start/End: Complemental strand, 44802959 - 44802582
Alignment:
| Q |
2 |
tcagcagcctttcaaaccccaagcttctcttcaactcatcaggattcccacaaaccatcaagatctcaccagcaacaccgctgcagacacggtggggtgt |
101 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
44802959 |
tcagcagcctttcaaaccccaagcttctcttcaactcatcaggattcccacaaaccatcaagatctcaccagcaacaccactgcagacacggtggggtgt |
44802860 |
T |
 |
| Q |
102 |
agccagatcgggtcggatgacggtggttcgacccgttcgtgctgcaccagaacagatatcaaagaaggtagaagagagcataaagagtgcacaagagacg |
201 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
44802859 |
agccggatcgggtcggatgacggtggttcgacccgttcgtgctgcaccagaacagatatcaaagaaggttgaagagagcataaagagtgcacaagagacg |
44802760 |
T |
 |
| Q |
202 |
tgtgctgatgacccagttagtggagaatgcgtagcagcatgggatgaagtggaggaactcagtgctgcagcgagtcatgcaagggataggaagaaggatt |
301 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44802759 |
tgtgctgatgacccagttagtggagaatgcgtagcagcatgggatgaagtggaggaactcagtgctgcagcgagtcatgcaagggataggaagaaggatt |
44802660 |
T |
 |
| Q |
302 |
ctgaccccttggaggattactgtaaggataaccctgaaaccgacgagtgcaaaacatttgatacctgatttattatga |
379 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44802659 |
ctgaccccttggaggattactgtaaggataaccctgaaaccgacgagtgcaaaacatttgatacctgatttattatga |
44802582 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 373 - 406
Target Start/End: Complemental strand, 44802561 - 44802528
Alignment:
| Q |
373 |
attatgagcattgattagtggtactgctgcactt |
406 |
Q |
| |
|
||||||||||||||||| |||||||||||||||| |
|
|
| T |
44802561 |
attatgagcattgattaatggtactgctgcactt |
44802528 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University