View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5654_2D_low_95 (Length: 308)
Name: NF5654_2D_low_95
Description: NF5654_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5654_2D_low_95 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 289; Significance: 1e-162; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 289; E-Value: 1e-162
Query Start/End: Original strand, 1 - 289
Target Start/End: Complemental strand, 37721303 - 37721015
Alignment:
| Q |
1 |
aaatgattttgttactaagtactactagtagtacaaaagttggttggtaaccaatacatgatgcaattgtcctatggtttttagataagcagtattcgat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37721303 |
aaatgattttgttactaagtactactagtagtacaaaagttggttggtaaccaatacatgatgcaattgtcctatggtttttagataagcagtattcgat |
37721204 |
T |
 |
| Q |
101 |
ttactggacgaagcaggtaggacgcagacaacagaaattaaatcaccttaagtctagcacccgatgctgaaatcgtacaaccacgcgagtgaggacggag |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37721203 |
ttactggacgaagcaggtaggacgcagacaacagaaattaaatcaccttaagtctagcacccgatgctgaaatcgtacaaccacgcgagtgaggacggag |
37721104 |
T |
 |
| Q |
201 |
actattgaattttgagtgaacatcgaatgccttgaggattgtttgcacactatcactcgcccgaacctctactcgacatattgtcttct |
289 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37721103 |
actattgaattttgagtgaacatcgaatgccttgaggattgtttgcacactatcactcgcccgaacctctactcgacatattgtcttct |
37721015 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 55 - 87
Target Start/End: Original strand, 28045603 - 28045635
Alignment:
| Q |
55 |
tacatgatgcaattgtcctatggtttttagata |
87 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| |
|
|
| T |
28045603 |
tacatgatgcaattgtcctatgatttttagata |
28045635 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University