View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5654_high_20 (Length: 274)

Name: NF5654_high_20
Description: NF5654
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5654_high_20
NF5654_high_20
[»] chr1 (2 HSPs)
chr1 (10-146)||(23304879-23305016)
chr1 (209-258)||(23304828-23304876)


Alignment Details
Target: chr1 (Bit Score: 130; Significance: 2e-67; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 10 - 146
Target Start/End: Complemental strand, 23305016 - 23304879
Alignment:
10 catcatcacaaattgagaaaagagggatcacaaagtagaaataaatataaaccctaaccgaggagagaagttactaaaacctaaaacctcggcgtagata 109  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
23305016 catcatcacaaattgagaaaagagggatcacaaagtagaaataaatataaaccctaaccgaggagagaagttactaaaacctaaaacctcggcgtagata 23304917  T
110 gaaagcagaaccttgtagcatgcgtatg-cgtatgagt 146  Q
    |||||||||||||||||||||||||||| |||||||||    
23304916 gaaagcagaaccttgtagcatgcgtatgccgtatgagt 23304879  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 209 - 258
Target Start/End: Complemental strand, 23304876 - 23304828
Alignment:
209 gtgttaaatatgtttgttttgggggaacgagaaaaaggggatacaccgag 258  Q
    |||||||||||||||||||||||| ||||||||||| |||||||||||||    
23304876 gtgttaaatatgtttgttttgggg-aacgagaaaaatgggatacaccgag 23304828  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University