View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5654_high_27 (Length: 249)
Name: NF5654_high_27
Description: NF5654
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5654_high_27 |
 |  |
|
| [»] chr5 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 213; Significance: 1e-117; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 5 - 249
Target Start/End: Original strand, 5146739 - 5146983
Alignment:
| Q |
5 |
ttaggttcgttcctacataacaatttctcttcaagttgtacgtcccatgtggctccactcattcacgatggttctctgtctttctcacttcctagggtgg |
104 |
Q |
| |
|
||||||||||| ||||| || |||||||||| | |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
5146739 |
ttaggttcgtttctacacaagaatttctcttgatgttgtacgtcccatgtggctccactcattctcgatggttctctgtctttctcacttcctagggtgg |
5146838 |
T |
 |
| Q |
105 |
gggaaaaatggatgagtatatatctaaccaattaattggtgatcaaggtcagcgaaaattagtatactgacgcctcctaatatgttcaaacagtgaattc |
204 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5146839 |
gggaaaaatggatgagtatatatctaaccaattaattggtgatcaaggtcaacgaaaattagtatactgacgcctcctaatatgttcaaacagtgaattc |
5146938 |
T |
 |
| Q |
205 |
aagacttaattttgaagaacaaagaacgtacatgtatttggctca |
249 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
5146939 |
aagacttaattttgaagaacaaagaacgtacatgtagttggctca |
5146983 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 33
Target Start/End: Original strand, 33377880 - 33377912
Alignment:
| Q |
1 |
tatgttaggttcgttcctacataacaatttctc |
33 |
Q |
| |
|
|||||||||||||||||||||||| |||||||| |
|
|
| T |
33377880 |
tatgttaggttcgttcctacataagaatttctc |
33377912 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 37
Target Start/End: Original strand, 15332894 - 15332930
Alignment:
| Q |
1 |
tatgttaggttcgttcctacataacaatttctcttca |
37 |
Q |
| |
|
||||||||||||||||||||| || |||||||||||| |
|
|
| T |
15332894 |
tatgttaggttcgttcctacacaagaatttctcttca |
15332930 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University