View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5654_low_18 (Length: 307)
Name: NF5654_low_18
Description: NF5654
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5654_low_18 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 238; Significance: 1e-132; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 238; E-Value: 1e-132
Query Start/End: Original strand, 16 - 265
Target Start/End: Original strand, 37172836 - 37173085
Alignment:
| Q |
16 |
attcaatgtgtcattgtgcaagtcatgcatgagttgggaaacaagtgtcttaaaatcaaaatagtcataaaatcattaagcaaatcctaaaaccactacc |
115 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37172836 |
attcaatgtgtcattgtgcaagtcctgcatgagttgggaaacaagtgtcttaaaatcaaaatagtcataaaatcattaagcaaatcctaaaaccactacc |
37172935 |
T |
 |
| Q |
116 |
taccatgaataaagcagaaaatgatgatgaagttgcaacactaaatcgaagcatccctcaccgagcaacgaagaaagggttcgactttagatgtggcaga |
215 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37172936 |
taccatgaataaagcagaaaatgaagatgaagttgcaacactaaatcgaagcatccctcaccgagcaacgaagaaagggttcgactttagatgtggcaga |
37173035 |
T |
 |
| Q |
216 |
tttgagtgtttgagatattctagtagactcatccattgctatggccaact |
265 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37173036 |
tttgactgtttgagatattctagtagactcatccattgctatggccaact |
37173085 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University