View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5654_low_20 (Length: 274)
Name: NF5654_low_20
Description: NF5654
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5654_low_20 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 130; Significance: 2e-67; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 10 - 146
Target Start/End: Complemental strand, 23305016 - 23304879
Alignment:
| Q |
10 |
catcatcacaaattgagaaaagagggatcacaaagtagaaataaatataaaccctaaccgaggagagaagttactaaaacctaaaacctcggcgtagata |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23305016 |
catcatcacaaattgagaaaagagggatcacaaagtagaaataaatataaaccctaaccgaggagagaagttactaaaacctaaaacctcggcgtagata |
23304917 |
T |
|
| Q |
110 |
gaaagcagaaccttgtagcatgcgtatg-cgtatgagt |
146 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
23304916 |
gaaagcagaaccttgtagcatgcgtatgccgtatgagt |
23304879 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 209 - 258
Target Start/End: Complemental strand, 23304876 - 23304828
Alignment:
| Q |
209 |
gtgttaaatatgtttgttttgggggaacgagaaaaaggggatacaccgag |
258 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||| ||||||||||||| |
|
|
| T |
23304876 |
gtgttaaatatgtttgttttgggg-aacgagaaaaatgggatacaccgag |
23304828 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University