View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5654_low_21 (Length: 262)
Name: NF5654_low_21
Description: NF5654
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5654_low_21 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 250; Significance: 1e-139; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 250; E-Value: 1e-139
Query Start/End: Original strand, 1 - 254
Target Start/End: Original strand, 19198431 - 19198684
Alignment:
| Q |
1 |
ctttacctgataatcgcttggatatactactgagaagggactttgaagattttgagctgtctaccttgcttttgaccttggccaatgaggcctccggggt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19198431 |
ctttacctgataatcgcttggatatactactgagaagggactttgaagattttgagctgtctaccttgcttttgaccttggccaatgaggcctccggggt |
19198530 |
T |
 |
| Q |
101 |
ctcactcttctgctcagaggtctcttgcaaattaattgagaatgcagcagcagctactgctgcaccatgcaccatatctatgtagtcgcaatcacgacct |
200 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19198531 |
ctcactcttctgctcagaggtctattgcaaattaattgagaatgcagcagcagctactgctgcaccatgcaccatatctatgtagtcgcaatcacgacct |
19198630 |
T |
 |
| Q |
201 |
gttttacttgaaagctgtttttgtaaccaactctggccctttttcttctctgct |
254 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19198631 |
gttttacttgaaagctgtttttgtaaccaactctggccctttttcttctctgct |
19198684 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 1 - 254
Target Start/End: Original strand, 19202502 - 19202755
Alignment:
| Q |
1 |
ctttacctgataatcgcttggatatactactgagaagggactttgaagattttgagctgtctaccttgcttttgaccttggccaatgaggcctccggggt |
100 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||| | |||||||||||||||||| |||||||||||||||| |
|
|
| T |
19202502 |
ctttacctgataatcgcttggatgcactactgagaagggactttgaagattttgtgctgtccatgttgcttttgaccttggccgatgaggcctccggggt |
19202601 |
T |
 |
| Q |
101 |
ctcactcttctgctcagaggtctcttgcaaattaattgagaatgcagcagcagctactgctgcaccatgcaccatatctatgtagtcgcaatcacgacct |
200 |
Q |
| |
|
|||||||||||||||| | |||||||||||||||||||| |||||||||||||||||||||||| |||||||||| |||||||||||| ||||||| ||| |
|
|
| T |
19202602 |
ctcactcttctgctcaaatgtctcttgcaaattaattgataatgcagcagcagctactgctgcagcatgcaccatttctatgtagtcgtaatcacggcct |
19202701 |
T |
 |
| Q |
201 |
gttttacttgaaagctgtttttgtaaccaactctggccctttttcttctctgct |
254 |
Q |
| |
|
||||||||||||||||||||||| |||||| |||||||||| |||||||||||| |
|
|
| T |
19202702 |
gttttacttgaaagctgtttttgcaaccaattctggcccttcttcttctctgct |
19202755 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University