View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5654_low_22 (Length: 260)
Name: NF5654_low_22
Description: NF5654
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5654_low_22 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 82; Significance: 8e-39; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 82; E-Value: 8e-39
Query Start/End: Original strand, 1 - 132
Target Start/End: Complemental strand, 3873839 - 3873707
Alignment:
| Q |
1 |
tatatcccccttatattttcttcgttgtgtttttattatctgaaactcagaagnnnnnnnnn-ctccatctcatcgaagccattgtgttctcactattat |
99 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||| |||||| ||||||||| |
|
|
| T |
3873839 |
tatatcccccttatattttcttcattgtgtttttattatctgaaactcagaagaaaaaaaaaactccatctcatcgaagccactgtgttatcactattag |
3873740 |
T |
|
| Q |
100 |
cttttgaagatgacaaaggttaaaatccacacc |
132 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
3873739 |
cttttgaagatgacaaaggttaaaatccacacc |
3873707 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 198 - 250
Target Start/End: Complemental strand, 3873638 - 3873586
Alignment:
| Q |
198 |
ctattcgttagtttgtattcagcagttttaatactcacttatatccctttcat |
250 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3873638 |
ctattcgttagtttgtattcagcagttttaatactcacttatatccctttcat |
3873586 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University