View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5654_low_23 (Length: 256)
Name: NF5654_low_23
Description: NF5654
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5654_low_23 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 218; Significance: 1e-120; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 1 - 238
Target Start/End: Complemental strand, 5146445 - 5146208
Alignment:
| Q |
1 |
gacattatactttaacctaaaattttaaaattttaagtatatgagtcatcttctttataaagtattcaacgtccacatttttaaacattatgaaacttct |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5146445 |
gacattatactttaacctaaaattttaaaattttaggtgtatgagtcatcttctttataaagtattcaacgtccacatttttaaacattatgaaacttct |
5146346 |
T |
 |
| Q |
101 |
aaatcatacttattatacacaacaaatgagagaagtctattgtagatgctcactagtaaattgatccaattcaaaataattaaattaagttattcattcc |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
5146345 |
aaatcatacttattatacacaacaaatgagagaagtctattgtagatgctcacaagtaaattgatccaattcaaaataattaaattaagttactcattcc |
5146246 |
T |
 |
| Q |
201 |
tttatattttggtcaataattgtgctaaaggtcacaat |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
5146245 |
tttatattttggtcaataattgtgctaaaggtctcaat |
5146208 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 138 - 184
Target Start/End: Complemental strand, 5146182 - 5146136
Alignment:
| Q |
138 |
tattgtagatgctcactagtaaattgatccaattcaaaataattaaa |
184 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
5146182 |
tattgtagatgctcacaagtaaattgatccaattcaaaataattaaa |
5146136 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University