View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5654_low_26 (Length: 250)
Name: NF5654_low_26
Description: NF5654
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5654_low_26 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 221; Significance: 1e-122; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 1 - 240
Target Start/End: Original strand, 10523220 - 10523457
Alignment:
| Q |
1 |
tcaaagagcctagtggcgaactgacatacacttggtgtttagaagtggccaattgtgggtttgaacctgcgtccgagcttatcaaatgtccctgcagctt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
10523220 |
tcaaagagcctagtggcgaactgacatacacttggtgtttagaagtggccaattgtgggtttgaacctgcttccgagcttatcaaatgtccctgcagctt |
10523319 |
T |
 |
| Q |
101 |
tttaccatttgacctgtacttacaggatgtttatgcttgtatgataaaattgtttatttttatgttatctatcttggctttttatctttcatacatatgg |
200 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
10523320 |
tttaccatttgac--gtacttacaggatgtttatgcttgtatgataaaattgtttatttttatgttatctatcttggctttttatctttcatacttatgg |
10523417 |
T |
 |
| Q |
201 |
gatgtttaaagtaactgataactggatttggttacctttg |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10523418 |
gatgtttaaagtaactgataactggatttggttacctttg |
10523457 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University