View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5654_low_29 (Length: 237)
Name: NF5654_low_29
Description: NF5654
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5654_low_29 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 217; Significance: 1e-119; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 43259561 - 43259341
Alignment:
| Q |
1 |
atgtgtcaagtatgaaattgactttatttggcctcatcatcacttgcagccttccgggtgactttggatttgaccctctaggactttcagatcccgaagg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43259561 |
atgtgtcaagtatgaaattgactttatttggcctcatcatcacttgcagccttccgggtgactttggatttgaccctctaggactttcagatcccgaagg |
43259462 |
T |
|
| Q |
101 |
aaccggtggattcattgaaccaagatggttagcatacggtgagataatcaacggccgatttgcaatgttgggagcagccggagctatagcacctgaaatt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43259461 |
aaccggtggattcattgaaccaagatggttagcatacggtgagataatcaacggccgatttgcaatgttgggagcagccggagctatagcacctgaaatt |
43259362 |
T |
|
| Q |
201 |
ctcggcaaagcaggtttaatt |
221 |
Q |
| |
|
|| |||||||||||||||||| |
|
|
| T |
43259361 |
cttggcaaagcaggtttaatt |
43259341 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 43256295 - 43256075
Alignment:
| Q |
1 |
atgtgtcaagtatgaaattgactttatttggcctcatcatcacttgcagccttccgggtgactttggatttgaccctctaggactttcagatcccgaagg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
43256295 |
atgtgtcaagtatgaaattgactttatttggcctcatcatcacttgcagccttcctggtgactttggatttgaccctctaggactttcagatcctgaagg |
43256196 |
T |
|
| Q |
101 |
aaccggtggattcattgaaccaagatggttagcatacggtgagataatcaacggccgatttgcaatgttgggagcagccggagctatagcacctgaaatt |
200 |
Q |
| |
|
| ||||||||||||||| ||| ||||||||||||||| ||||||||||||||||| || ||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
43256195 |
agtcggtggattcattgagccagaatggttagcatacggcgagataatcaacggccgcttcgcaatgttgggagcagcaggagctatagcacctgaaatt |
43256096 |
T |
|
| Q |
201 |
ctcggcaaagcaggtttaatt |
221 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
43256095 |
ctcggcaaagcaggtttaatt |
43256075 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University