View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5654_low_30 (Length: 228)
Name: NF5654_low_30
Description: NF5654
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5654_low_30 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 20 - 215
Target Start/End: Complemental strand, 55456173 - 55455978
Alignment:
| Q |
20 |
aggaggtgacaaaaatgcaggtgatggaattgttattggtattgttgatagtggcattaatccaattcatccaagctttgcttaccaacctttcacttca |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55456173 |
aggaggtgacaaaaatgcaggtgatggaattgttattggtattgttgatagtggcattaatccaattcatccaagctttgcttaccaacctttcacttca |
55456074 |
T |
|
| Q |
120 |
aatatctctcacttttctggtgcttgtgagactggtccacatttcccacctggttcttgcaatggaaagattatttcagctaaatatttctctgct |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55456073 |
aatatctctcacttttctggtgcttgtgagactggtccacatttcccacctggttcttgcaatggaaagattatttcagctaaatatttctctgct |
55455978 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University