View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5654_low_32 (Length: 214)
Name: NF5654_low_32
Description: NF5654
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5654_low_32 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 119; Significance: 6e-61; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 119; E-Value: 6e-61
Query Start/End: Original strand, 96 - 214
Target Start/End: Complemental strand, 35443393 - 35443275
Alignment:
| Q |
96 |
ctctaatatttgcgatacgtcaagtggatccgcaatgcatactcttattactcgtcaagatgttgaccaggtaattaattgacctctctctaatgatatg |
195 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35443393 |
ctctaatatttgcgatacgtcaagtggatccgcaatgcatactcttattactcgtcaagatgttgaccaggtaattaattgacctctctctaatgatatg |
35443294 |
T |
|
| Q |
196 |
atacacttcactcattgtt |
214 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
35443293 |
atacacttcactcattgtt |
35443275 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University