View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5655-Insertion-1 (Length: 170)
Name: NF5655-Insertion-1
Description: NF5655
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5655-Insertion-1 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 155; Significance: 1e-82; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 155; E-Value: 1e-82
Query Start/End: Original strand, 7 - 169
Target Start/End: Original strand, 26460700 - 26460862
Alignment:
| Q |
7 |
agaaacaaacctgatacatccttcccgtgtccaacatcccttcactctcacaggctgaattttccttttccaggtgcatcatttctacatcctccactgt |
106 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26460700 |
agaaacaaacctgatacatccttcctgtgtccaacatcccttcactctcacaggctgaattttccttttccaggtgcatcatttctacatcctccactgt |
26460799 |
T |
|
| Q |
107 |
ctttccccgtgccttcctcttctttgctttcattacctactcaacctcttccaaccaaaacac |
169 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
26460800 |
ctttccccgtgccttcctcttctttgctttcattaccttctcaacctcttccaaccaaaacac |
26460862 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University