View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5655-Insertion-5 (Length: 211)
Name: NF5655-Insertion-5
Description: NF5655
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5655-Insertion-5 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 138; Significance: 3e-72; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 10 - 193
Target Start/End: Original strand, 6495313 - 6495500
Alignment:
| Q |
10 |
aatggatgccgtggct--ctc--caagcagactccactgacatgatttcattattgtaccaaaatatattttagtatacagcaatatcttaccgaaagtt |
105 |
Q |
| |
|
|||||||||||||||| ||| |||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6495313 |
aatggatgccgtggcttgctcatcaagcagattccactgacatgatttcattatggtaccaaaatatattttagtatacagcaatatcttaccgaaagtt |
6495412 |
T |
|
| Q |
106 |
taggttggcagattataataaatagtgatgcattacaaaataacaaatgaaataatgctaaaagttttcgttaaaagagattccaact |
193 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||| ||||||||| ||||||||| |
|
|
| T |
6495413 |
aaggttggcagattataataaacagtgatgcattacaaaataacaaatgaaataatactaaaagtttttgttaaaagatattccaact |
6495500 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University