View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5656-Insertion-5 (Length: 200)
Name: NF5656-Insertion-5
Description: NF5656
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5656-Insertion-5 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 107; Significance: 7e-54; HSPs: 7)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 107; E-Value: 7e-54
Query Start/End: Original strand, 8 - 181
Target Start/End: Original strand, 27215107 - 27215281
Alignment:
| Q |
8 |
ttgtcccccctctgtcgcgagggttatttctaccaatgttgctgg-gggattgccccatcaccgttgcaaccgatttgaccagaggcacaatcggcggcg |
106 |
Q |
| |
|
||||||||| | ||| || | |||||||||||||||||||||||| |||||||| ||| |||| |||||||||| ||||||||||||||||||||||| | |
|
|
| T |
27215107 |
ttgtcccccgtttgttgctacggttatttctaccaatgttgctggtgggattgcgccagcaccattgcaaccgagttgaccagaggcacaatcggcggtg |
27215206 |
T |
|
| Q |
107 |
gcacagctgaactttccattggtgtctgagcatccagttcggccccaaaatcgaccagaccatggtgatggaagg |
181 |
Q |
| |
|
||||||||||||||||||||| ||| ||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27215207 |
gcacagctgaactttccattgttgttgaagcatccggttcggccccaaaatcgaccagaccatggtgatggaagg |
27215281 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 107; E-Value: 7e-54
Query Start/End: Original strand, 8 - 181
Target Start/End: Original strand, 27221069 - 27221243
Alignment:
| Q |
8 |
ttgtcccccctctgtcgcgagggttatttctaccaatgttgctgg-gggattgccccatcaccgttgcaaccgatttgaccagaggcacaatcggcggcg |
106 |
Q |
| |
|
||||||||| ||||| || | ||||||||||||||||||||||| |||||||||||| ||||||||||||||| ||||||||||||||||||||||| | |
|
|
| T |
27221069 |
ttgtcccccgtctgttgctaccgttatttctaccaatgttgctggtgggattgccccagcaccgttgcaaccgacttgaccagaggcacaatcggcggtg |
27221168 |
T |
|
| Q |
107 |
gcacagctgaactttccattggtgtctgagcatccagttcggccccaaaatcgaccagaccatggtgatggaagg |
181 |
Q |
| |
|
||||||||||||||||||||| ||| ||||||| |||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
27221169 |
gcacagctgaactttccattgttgttgaagcatccggttcggccccaaaatctacccgaccatggtgatggaagg |
27221243 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 107; E-Value: 7e-54
Query Start/End: Original strand, 8 - 181
Target Start/End: Complemental strand, 27443794 - 27443620
Alignment:
| Q |
8 |
ttgtcccccctctgtcgcgagggttatttctaccaatgttgctgg-gggattgccccatcaccgttgcaaccgatttgaccagaggcacaatcggcggcg |
106 |
Q |
| |
|
||||||||| | ||| || | |||||||||||||||||||||||| |||||||| ||| |||| |||||||||| ||||||||||||||||||||||| | |
|
|
| T |
27443794 |
ttgtcccccgtttgttgctacggttatttctaccaatgttgctggtgggattgcgccagcaccattgcaaccgagttgaccagaggcacaatcggcggtg |
27443695 |
T |
|
| Q |
107 |
gcacagctgaactttccattggtgtctgagcatccagttcggccccaaaatcgaccagaccatggtgatggaagg |
181 |
Q |
| |
|
||||||||||||||||||||| ||| ||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27443694 |
gcacagctgaactttccattgttgttgaagcatccggttcggccccaaaatcgaccagaccatggtgatggaagg |
27443620 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 99; E-Value: 4e-49
Query Start/End: Original strand, 8 - 181
Target Start/End: Original strand, 27432816 - 27432990
Alignment:
| Q |
8 |
ttgtcccccctctgtcgcgagggttatttctaccaatgttgctgg-gggattgccccatcaccgttgcaaccgatttgaccagaggcacaatcggcggcg |
106 |
Q |
| |
|
||||||||| | ||| || | |||||||||||||||||||||||| |||||||| ||| ||||||| ||||||| ||||||||||||||||||||||| | |
|
|
| T |
27432816 |
ttgtcccccgtttgttgctacggttatttctaccaatgttgctggtgggattgcgccagcaccgttacaaccgacttgaccagaggcacaatcggcggtg |
27432915 |
T |
|
| Q |
107 |
gcacagctgaactttccattggtgtctgagcatccagttcggccccaaaatcgaccagaccatggtgatggaagg |
181 |
Q |
| |
|
||||| ||||||||||||||| ||| |||||||| ||||| |||||||||||||| |||||||||||||||||| |
|
|
| T |
27432916 |
gcacaactgaactttccattgttgttggagcatccggttcgtccccaaaatcgacccgaccatggtgatggaagg |
27432990 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 89; E-Value: 4e-43
Query Start/End: Original strand, 30 - 181
Target Start/End: Original strand, 27207758 - 27207910
Alignment:
| Q |
30 |
gttatttctaccaatgttgctgg-gggattgccccatcaccgttgcaaccgatttgaccagaggcacaatcggcggcggcacagctgaactttccattgg |
128 |
Q |
| |
|
||||||||||||| ||||||||| |||||||| ||| ||||||||||||||| |||||| |||||||||||||||| ||| ||||||||| |||| ||| |
|
|
| T |
27207758 |
gttatttctaccagtgttgctggtgggattgcgccagcaccgttgcaaccgacttgaccggaggcacaatcggcggtggcgcagctgaaccttccgttgt |
27207857 |
T |
|
| Q |
129 |
tgtctgagcatccagttcggccccaaaatcgaccagaccatggtgatggaagg |
181 |
Q |
| |
|
|||| ||||||||||||||||||||||||| || |||||||||||||||||| |
|
|
| T |
27207858 |
tgtcggagcatccagttcggccccaaaatcttcccgaccatggtgatggaagg |
27207910 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 40; E-Value: 0.00000000000007
Query Start/End: Original strand, 33 - 171
Target Start/End: Original strand, 27389055 - 27389194
Alignment:
| Q |
33 |
atttctaccaatgttgctgg-gggattgccccatcaccgttgcaaccgatttgaccagaggcacaatcggcggcggcacagctgaactttccattggtgt |
131 |
Q |
| |
|
||||| ||||| |||||||| |||||||| ||| |||| ||||| | | ||||||||| ||||||||||| | |||||| | |||| ||| ||| || |
|
|
| T |
27389055 |
atttcaaccaaagttgctggtgggattgcgccagcaccattgcatgcaacttgaccagatgcacaatcggcagtggcacaagtaaactgtccgttgttgg |
27389154 |
T |
|
| Q |
132 |
ctgagcatccagttcggccccaaaatcgaccagaccatgg |
171 |
Q |
| |
|
||||||||| |||||| ||||||||||||| |||||||| |
|
|
| T |
27389155 |
ttgagcatccggttcgggcccaaaatcgacctgaccatgg |
27389194 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 45 - 170
Target Start/End: Original strand, 27410023 - 27410149
Alignment:
| Q |
45 |
gttgctgg-gggattgccccatcaccgttgcaaccgatttgaccagaggcacaatcggcggcggcacagctgaactttccattggtgtctgagcatccag |
143 |
Q |
| |
|
|||||||| |||||||| ||| |||| ||||| || | ||||||||| |||||||||| | |||||| || |||||| | ||| || ||||||||| | |
|
|
| T |
27410023 |
gttgctggtgggattgcgccagcaccattgcaccccacttgaccagacccacaatcggctgtggcacaactaaacttttctttgttgattgagcatccgg |
27410122 |
T |
|
| Q |
144 |
ttcggccccaaaatcgaccagaccatg |
170 |
Q |
| |
|
||| ||||||||||||||||||||| |
|
|
| T |
27410123 |
ttcttgcccaaaatcgaccagaccatg |
27410149 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University