View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5656_high_4 (Length: 221)
Name: NF5656_high_4
Description: NF5656
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5656_high_4 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 151; Significance: 5e-80; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 151; E-Value: 5e-80
Query Start/End: Original strand, 1 - 151
Target Start/End: Original strand, 41169505 - 41169655
Alignment:
| Q |
1 |
gacaaggaaaccaaaatcttagatttaggcattattttgagtacctttctgtgattaactctcgatggatgtaattttactttgaatgtttttggtaatc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41169505 |
gacaaggaaaccaaaatcttagatttaggcattattttgagtacctttctgtgattaactctcgatggatgtaattttactttgaatgtttttggtaatc |
41169604 |
T |
|
| Q |
101 |
aactctagatgtctgatatttcttttatgttttatgattttgtggtattac |
151 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41169605 |
aactctagatgtctgatatttcttttatgttttatgattttgtggtattac |
41169655 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 182 - 211
Target Start/End: Original strand, 41169656 - 41169685
Alignment:
| Q |
182 |
gactttgtttggtatctatgaatgatgatg |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
41169656 |
gactttgtttggtatctatgaatgatgatg |
41169685 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University