View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5656_low_3 (Length: 360)
Name: NF5656_low_3
Description: NF5656
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5656_low_3 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 134; Significance: 1e-69; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 134; E-Value: 1e-69
Query Start/End: Original strand, 195 - 340
Target Start/End: Original strand, 8930887 - 8931032
Alignment:
| Q |
195 |
gaacctgtggcaaatatgtgaatgagtttattacgaataaactaacagataaaatttaaagtttactagtttaaaagtgaatagttgaaccaattatatt |
294 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
8930887 |
gaacctgtgacaaatatgtgaatgagtttattacgattaaactaacagataaaatttaaagtttactagtttaaaagtaaatagttgaaccaattatatt |
8930986 |
T |
|
| Q |
295 |
gcaacccaccaaagggcaagctgttagtttctataggagggtctgt |
340 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8930987 |
gcaacccaccaaagggcaagctgttagtttctataggagggtctgt |
8931032 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University