View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5656_low_4 (Length: 221)

Name: NF5656_low_4
Description: NF5656
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5656_low_4
NF5656_low_4
[»] chr8 (2 HSPs)
chr8 (1-151)||(41169505-41169655)
chr8 (182-211)||(41169656-41169685)


Alignment Details
Target: chr8 (Bit Score: 151; Significance: 5e-80; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 151; E-Value: 5e-80
Query Start/End: Original strand, 1 - 151
Target Start/End: Original strand, 41169505 - 41169655
Alignment:
1 gacaaggaaaccaaaatcttagatttaggcattattttgagtacctttctgtgattaactctcgatggatgtaattttactttgaatgtttttggtaatc 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
41169505 gacaaggaaaccaaaatcttagatttaggcattattttgagtacctttctgtgattaactctcgatggatgtaattttactttgaatgtttttggtaatc 41169604  T
101 aactctagatgtctgatatttcttttatgttttatgattttgtggtattac 151  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||    
41169605 aactctagatgtctgatatttcttttatgttttatgattttgtggtattac 41169655  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 182 - 211
Target Start/End: Original strand, 41169656 - 41169685
Alignment:
182 gactttgtttggtatctatgaatgatgatg 211  Q
    ||||||||||||||||||||||||||||||    
41169656 gactttgtttggtatctatgaatgatgatg 41169685  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University