View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5656_low_5 (Length: 208)

Name: NF5656_low_5
Description: NF5656
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5656_low_5
NF5656_low_5
[»] chr4 (1 HSPs)
chr4 (18-204)||(15508939-15509124)


Alignment Details
Target: chr4 (Bit Score: 121; Significance: 3e-62; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 121; E-Value: 3e-62
Query Start/End: Original strand, 18 - 204
Target Start/End: Original strand, 15508939 - 15509124
Alignment:
18 aggaagatgagctttgtatagaagattcttcttttttatctttcattcatattcatatttatggaaaacaggtacatttatgtatttcataggtttttct 117  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||    
15508939 aggaagatgagctttgtatagaagattcttcttttttatctttcattcatattcatatttatggaaaacaggtacatttatgtatttcatacgtttttct 15509038  T
118 tttatattaatccactgcaaatgcgtcccnnnnnnnnnnnnnnntcgccgtagttaaggctttgtacgatgttattgatgatgtcca 204  Q
    ||||||||||||||| |||||||||||||               ||| |||||||||||||||||||||||||||||||||| ||||    
15509039 tttatattaatccaccgcaaatgcgtcccaaaaaaataaaaaa-tcgtcgtagttaaggctttgtacgatgttattgatgatatcca 15509124  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University