View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5656_low_5 (Length: 208)
Name: NF5656_low_5
Description: NF5656
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5656_low_5 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 121; Significance: 3e-62; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 121; E-Value: 3e-62
Query Start/End: Original strand, 18 - 204
Target Start/End: Original strand, 15508939 - 15509124
Alignment:
| Q |
18 |
aggaagatgagctttgtatagaagattcttcttttttatctttcattcatattcatatttatggaaaacaggtacatttatgtatttcataggtttttct |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
15508939 |
aggaagatgagctttgtatagaagattcttcttttttatctttcattcatattcatatttatggaaaacaggtacatttatgtatttcatacgtttttct |
15509038 |
T |
 |
| Q |
118 |
tttatattaatccactgcaaatgcgtcccnnnnnnnnnnnnnnntcgccgtagttaaggctttgtacgatgttattgatgatgtcca |
204 |
Q |
| |
|
||||||||||||||| ||||||||||||| ||| |||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
15509039 |
tttatattaatccaccgcaaatgcgtcccaaaaaaataaaaaa-tcgtcgtagttaaggctttgtacgatgttattgatgatatcca |
15509124 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University