View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5657_high_4 (Length: 241)
Name: NF5657_high_4
Description: NF5657
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5657_high_4 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 128; Significance: 3e-66; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 128; E-Value: 3e-66
Query Start/End: Original strand, 18 - 241
Target Start/End: Complemental strand, 32077969 - 32077750
Alignment:
| Q |
18 |
agttctatcgaatccatgtagatagcttttacatactcactcttaacttcaagtttgatttcattaaaagacaagcaaatataactctaatttaactgga |
117 |
Q |
| |
|
|||||||| ||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| || || |
|
|
| T |
32077969 |
agttctattgaatccatgtagataacttttacatactcactct-aacttcaagtttgatttcattaaaagacaagcaaatataactctaatttagctaga |
32077871 |
T |
|
| Q |
118 |
ggatccttattaaagtctagtccacacnnnnnnnnnnnnnnnnnggtagatagtccacacatgttttactctatcattcattatgtttcacttcttattg |
217 |
Q |
| |
|
|| |||||||||||||||||||||||| ||||||||||| |||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32077870 |
gggtccttattaaagtctagtccacac---tttttttttttttgggtagatagtcaacacattttttactctatcattcattatgtttcacttcttattg |
32077774 |
T |
|
| Q |
218 |
ttgatgaaatgatctaagatcatt |
241 |
Q |
| |
|
|||||||||||| ||||||||||| |
|
|
| T |
32077773 |
ttgatgaaatgaactaagatcatt |
32077750 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University