View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5658_low_3 (Length: 228)
Name: NF5658_low_3
Description: NF5658
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5658_low_3 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 7 - 207
Target Start/End: Original strand, 48636577 - 48636777
Alignment:
| Q |
7 |
ctctatgcggtgttgatatttctaatttaactgaggaacagcgaaatcttcatactaatgattgtcttgataaatctggagaagatgtaagattttcgat |
106 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48636577 |
ctctatgcggtgttgatatatctaatttaactgaggaacagcgaaatcttcatactaatgattgtcttgataaatctggagaagatgtaagattttcgat |
48636676 |
T |
 |
| Q |
107 |
acacactctttatagtttattattattgataatgataactatgctgttaaattgtgcattaattttatgttttgtcgaactttagtgttcaagcttgata |
206 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48636677 |
acacactctttataatttattattattgataatgataactatgctgttaaattgtgcattaattttatgttttgtcgaactttagtgttcaagcttgata |
48636776 |
T |
 |
| Q |
207 |
g |
207 |
Q |
| |
|
| |
|
|
| T |
48636777 |
g |
48636777 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University