View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5659-Insertion-3 (Length: 352)
Name: NF5659-Insertion-3
Description: NF5659
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5659-Insertion-3 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 153; Significance: 5e-81; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 153; E-Value: 5e-81
Query Start/End: Original strand, 8 - 172
Target Start/End: Original strand, 27725158 - 27725322
Alignment:
| Q |
8 |
gttggcagggtgaccccaatgtacaagccagtcaggcagattcagtgacttgactatctcaacgaaaggcgcaaacgcagatctcacagctccgtctgtt |
107 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27725158 |
gttggcagggtgaccccaatgtacgagccagtcaggcagattcagtgacttgactatctcaacgaaaggcgcaaacgcagatctcacagctccgtctgtt |
27725257 |
T |
|
| Q |
108 |
tagtttagtttagtttagtttaattcagttttgaaatgaattagaattaaggattgaattgtaaa |
172 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
27725258 |
tagtttagtttagtttagtttaattgagttttgaaatgaattagaattcaggattgaattgtaaa |
27725322 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 131; E-Value: 7e-68
Query Start/End: Original strand, 198 - 340
Target Start/End: Original strand, 27725338 - 27725480
Alignment:
| Q |
198 |
cctccgggtaagagagcagcggcgtaaagtaatgacaatggagagaaagagtgtaagattgtttcactttttggtctcgtggattctatggattgaggtg |
297 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27725338 |
cctccgggtaagagagcagcggcgtaaagtaatggcaatggagagaaagagtgtaagattgtttcactttttggtctcgtggattctatggattgaggtg |
27725437 |
T |
|
| Q |
298 |
agtcttcctttgtggcgtggcatttgaggtggaggggagttgt |
340 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| ||||||| |
|
|
| T |
27725438 |
agtcttcctttgtggcgtgacatttgaggtggaggcgagttgt |
27725480 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University