View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5659-Insertion-7 (Length: 285)
Name: NF5659-Insertion-7
Description: NF5659
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5659-Insertion-7 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 8 - 282
Target Start/End: Original strand, 1009337 - 1009610
Alignment:
| Q |
8 |
cattctacatccttcatacattgatctatctttttgcacccaaaaaacaagataataaagaaggaaaagaagggaaaatgtttgctgnnnnnnnngttaa |
107 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||| ||||| ||||| || || |||||||||||||||||||||||||||| ||||| |
|
|
| T |
1009337 |
cattctacatccttcatacattaatctatctttttgcacctaaaaatcaagagaaaaatgaaggaaaagaagggaaaatgtttgctgttttttt-gttaa |
1009435 |
T |
 |
| Q |
108 |
tctgacggagtacctcattttatcccgtaatattatctttgatatgattttatttattgtctctatttttcttcacaggcaaccctatctcttgcaatgg |
207 |
Q |
| |
|
|||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1009436 |
tctgacagagtacctaattttatcccgtaatattatctttgatatgattttatttattgtctttatttttcttcacaggcaaccctatctcttgcaatgg |
1009535 |
T |
 |
| Q |
208 |
aaattcttttatctgatgagaatggtttggaagacgttcagcagggtgttggccttcttatcaatgctatagttg |
282 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||| || |||||||||| |
|
|
| T |
1009536 |
aaattcttttatctgatgagaatggtttggcagacgttcagcagggtgttggccgtcttataaacgctatagttg |
1009610 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University