View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5659_1D_high_17 (Length: 207)

Name: NF5659_1D_high_17
Description: NF5659_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5659_1D_high_17
NF5659_1D_high_17
[»] chr4 (2 HSPs)
chr4 (135-187)||(2616492-2616544)
chr4 (84-115)||(2616560-2616591)


Alignment Details
Target: chr4 (Bit Score: 53; Significance: 1e-21; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 135 - 187
Target Start/End: Complemental strand, 2616544 - 2616492
Alignment:
135 gaataataaaatcaaaaaatggagctgagagaaaacgaaatgtaacaagtttt 187  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||    
2616544 gaataataaaatcaaaaaatggagctgagagaaaacgaaatgtaacaagtttt 2616492  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 84 - 115
Target Start/End: Complemental strand, 2616591 - 2616560
Alignment:
84 gtgttgaagaacccattgaattgaaattgaag 115  Q
    ||||||||||||||||||||||||||||||||    
2616591 gtgttgaagaacccattgaattgaaattgaag 2616560  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University