View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5659_1D_high_18 (Length: 205)
Name: NF5659_1D_high_18
Description: NF5659_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5659_1D_high_18 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 66; Significance: 2e-29; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 66; E-Value: 2e-29
Query Start/End: Original strand, 64 - 157
Target Start/End: Original strand, 1009249 - 1009342
Alignment:
| Q |
64 |
ccttgtattttatacaaatttacacggacatggctcagaaaatttcatccaatgttgccacctgcttatgtattatagtttatttctgcattct |
157 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||| |||||||| || ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1009249 |
ccttgtatttcatacaaatttacacggacatggcttggaaaatttgtgccgatgttgccacctgcttatgtattatagtttatttctgcattct |
1009342 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University