View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5659_1D_high_18 (Length: 205)

Name: NF5659_1D_high_18
Description: NF5659_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5659_1D_high_18
NF5659_1D_high_18
[»] chr7 (1 HSPs)
chr7 (64-157)||(1009249-1009342)


Alignment Details
Target: chr7 (Bit Score: 66; Significance: 2e-29; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 66; E-Value: 2e-29
Query Start/End: Original strand, 64 - 157
Target Start/End: Original strand, 1009249 - 1009342
Alignment:
64 ccttgtattttatacaaatttacacggacatggctcagaaaatttcatccaatgttgccacctgcttatgtattatagtttatttctgcattct 157  Q
    |||||||||| ||||||||||||||||||||||||  ||||||||   || |||||||||||||||||||||||||||||||||||||||||||    
1009249 ccttgtatttcatacaaatttacacggacatggcttggaaaatttgtgccgatgttgccacctgcttatgtattatagtttatttctgcattct 1009342  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University