View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5659_1D_low_10 (Length: 352)
Name: NF5659_1D_low_10
Description: NF5659_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5659_1D_low_10 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 247; Significance: 1e-137; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 247; E-Value: 1e-137
Query Start/End: Original strand, 22 - 344
Target Start/End: Original strand, 1794681 - 1795004
Alignment:
| Q |
22 |
tcttcttaaggaaagggaacatacaattctgagaacatatatgctcaagctctcataaaacaagtctccatggcatgaacccatcacatggaaatggaat |
121 |
Q |
| |
|
|||||||||| ||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
1794681 |
tcttcttaagaaaagggaacatacaattctcagaagatatatgctcaagctctcataaaacaagtctccatggcatgaacccattacatggaaatggaat |
1794780 |
T |
|
| Q |
122 |
caccaaaacaataagtataatc-tagccgcatccttcttttctcttttcctcttcaccttcttcaaccacttgataaggggtggtttaagaccattcttt |
220 |
Q |
| |
|
|||||||||||||| || ||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1794781 |
caccaaaacaataaatagtatcgtagccgcacccttcttttctcttttcctcttcaccttcttcaaccacttgataaggggtggtttaagaccattcttt |
1794880 |
T |
|
| Q |
221 |
ccccgctaaattattcatctaattagtttttcttttctcgctcttttatttaaataaatgattatcacatannnnnnnaaggagattatcaaatatatct |
320 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||| |||||||| |
|
|
| T |
1794881 |
ccccgctaaattatccatctaattagtttttcttttctcgctcttttatttaaataaatgattatcacatatttttttaagaagattatcacatatatct |
1794980 |
T |
|
| Q |
321 |
cttttctcgccctttttgaacacc |
344 |
Q |
| |
|
||||||| |||||||||||||||| |
|
|
| T |
1794981 |
cttttcttgccctttttgaacacc |
1795004 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University