View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5659_1D_low_19 (Length: 281)
Name: NF5659_1D_low_19
Description: NF5659_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5659_1D_low_19 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 253; Significance: 1e-141; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 253; E-Value: 1e-141
Query Start/End: Original strand, 1 - 281
Target Start/End: Original strand, 2620047 - 2620326
Alignment:
| Q |
1 |
gaaatgcaacaggtccgtgtcttggaacttgacaaattttgttggtgataatgcaagcataaccatatgtaaccagctgattttatgtgtttgttttggc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2620047 |
gaaatgcaacaggtccgtgtcttggaacttgccaaattttgttggtgataatgcaagcataaccatatgtaaccagctgattttatgtgtttgttttggc |
2620146 |
T |
 |
| Q |
101 |
gttgggggaatggtgaacgcatgttgagttagaagctatttattgcagcttttttatatcacggtgaattgacatgccttcttcgacttggaggttgatg |
200 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||| |
|
|
| T |
2620147 |
gtttggggaatggtgaacgcatgttgagttagaagctatttattgcagcttttttatatcacggtgaattgacatggcttcttcgactt-gaggttgatg |
2620245 |
T |
 |
| Q |
201 |
gccactctcccaaacgaaccgtttctttatcagtgttcaatgtgattgattgttctgaataaagaatttgtaggattattt |
281 |
Q |
| |
|
||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2620246 |
gccactctcccaaacaaaccgtttctttatgagtgttcaatgtgattgattgttctgaataaagaatttgtaggattattt |
2620326 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University