View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5659_1D_low_27 (Length: 250)
Name: NF5659_1D_low_27
Description: NF5659_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5659_1D_low_27 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 22 - 250
Target Start/End: Complemental strand, 29525984 - 29525756
Alignment:
| Q |
22 |
atcactttgccttactaattgtgtgccttcccaatcaagcttggcagttaattgttttctgttagtgtggttgtaactaacttgtactttggctaatggc |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||| |
|
|
| T |
29525984 |
atcactttgccttactaattgtgtgccttcccaatcaagcttggcagttaattgttttctgttaatgtggttgtaactaacttctactttggctaatggc |
29525885 |
T |
 |
| Q |
122 |
tatatataaagtcttaggagagaaaattattcattattaattttcatacctcgagtgctaagaatcagataagattaacagcaagaaatggtaagagtat |
221 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
29525884 |
tatatataaagtcttaggagagaaaattattcattattaattttcataccttgagtgctaagaatcagataagattaaccgcaagaaatggtaagagtat |
29525785 |
T |
 |
| Q |
222 |
tgattgagggattcatactgattcttaaa |
250 |
Q |
| |
|
||||||||||||||||| ||||||||||| |
|
|
| T |
29525784 |
tgattgagggattcatagtgattcttaaa |
29525756 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University