View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5659_1D_low_28 (Length: 244)
Name: NF5659_1D_low_28
Description: NF5659_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5659_1D_low_28 |
 | |
|
| [»] chr6 (2 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 218; Significance: 1e-120; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 19 - 244
Target Start/End: Original strand, 29524995 - 29525220
Alignment:
| Q |
19 |
ctgtggaccatcaattggatgctgatttcggttgctataatctttggttgcccgctctttgttatgcattcgtcttcgcattaccaagaagaggtcgaca |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29524995 |
ctgtggaccatcaattggatgctgatttcggttgctataatctttggttgcccgctctttgttatgcattcgtcttcgcattaccaagaagaggtcgaca |
29525094 |
T |
|
| Q |
119 |
gggatcaaattattgatgaatcttcaggttctgatccagaggttggtaatacaggtcaaccagatgttgcccatgaaagtcgtgttattattgattcata |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29525095 |
gggatcaaattattgatgaatcttcaggttctgatccagaggttggtaatacagttcaaccagatgttgcccatgaaagtcgtgttattattgattcata |
29525194 |
T |
|
| Q |
219 |
tctagattaccaacaagaggtatcta |
244 |
Q |
| |
|
||||||| |||||||||||||||||| |
|
|
| T |
29525195 |
tctagataaccaacaagaggtatcta |
29525220 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 133; E-Value: 3e-69
Query Start/End: Original strand, 19 - 187
Target Start/End: Original strand, 29612784 - 29612952
Alignment:
| Q |
19 |
ctgtggaccatcaattggatgctgatttcggttgctataatctttggttgcccgctctttgttatgcattcgtcttcgcattaccaagaagaggtcgaca |
118 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||| || ||||||||||||||||||||||| |||| |||||| |||||||||| |
|
|
| T |
29612784 |
ctgtggaccatcaattggatgctgattttggttgctataatctttggttgtccactctttgttatgcattcgtcttcacattcccaagatgaggtcgaca |
29612883 |
T |
|
| Q |
119 |
gggatcaaattattgatgaatcttcaggttctgatccagaggttggtaatacaggtcaaccagatgttg |
187 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
29612884 |
cggatcaaattattgatgaatcttcaggttctgatccagaggttggtaatgtaggtcaaccagatgttg |
29612952 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University