View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5659_1D_low_33 (Length: 224)
Name: NF5659_1D_low_33
Description: NF5659_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5659_1D_low_33 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 88; Significance: 2e-42; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 82 - 208
Target Start/End: Complemental strand, 53788241 - 53788114
Alignment:
| Q |
82 |
tgtaatggaagagaatgtcaagttgaatcaagatgctggaagtgattaaatattggaaagaaaattattcaaatactcaaataatggaa-cagttgattt |
180 |
Q |
| |
|
|||||| ||||||||||| || |||||||||||||||||||||||||||||||||| || ||||||||| |||||||||||||||||| | |||||||| |
|
|
| T |
53788241 |
tgtaatagaagagaatgttaaattgaatcaagatgctggaagtgattaaatattgggaaaaaaattattgcaatactcaaataatggaaccggttgattt |
53788142 |
T |
|
| Q |
181 |
tcccaacaagcatttgcaaatgaattta |
208 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
53788141 |
tcccaacaagcatttgcaaatgaattta |
53788114 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 4 - 33
Target Start/End: Complemental strand, 53788269 - 53788240
Alignment:
| Q |
4 |
ataatactaatgtatttccatggatttatg |
33 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
53788269 |
ataatactaatgtatttccatggatttatg |
53788240 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University