View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5659_1D_low_39 (Length: 207)
Name: NF5659_1D_low_39
Description: NF5659_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5659_1D_low_39 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 53; Significance: 1e-21; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 135 - 187
Target Start/End: Complemental strand, 2616544 - 2616492
Alignment:
| Q |
135 |
gaataataaaatcaaaaaatggagctgagagaaaacgaaatgtaacaagtttt |
187 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2616544 |
gaataataaaatcaaaaaatggagctgagagaaaacgaaatgtaacaagtttt |
2616492 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 84 - 115
Target Start/End: Complemental strand, 2616591 - 2616560
Alignment:
| Q |
84 |
gtgttgaagaacccattgaattgaaattgaag |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
2616591 |
gtgttgaagaacccattgaattgaaattgaag |
2616560 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University