View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5659_1D_low_4 (Length: 482)
Name: NF5659_1D_low_4
Description: NF5659_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5659_1D_low_4 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 401; Significance: 0; HSPs: 4)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 401; E-Value: 0
Query Start/End: Original strand, 1 - 429
Target Start/End: Complemental strand, 23333023 - 23332595
Alignment:
| Q |
1 |
ggttcattagtgggcattgcactgttttggtatgttgattggaactaaccgtgtcatgtgtttgatgtgttggtcagccgaagacaaggttgccatcgtg |
100 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23333023 |
ggttcatttgtgggcattgcactgttttggtatgttgattggaactaaccgtgtcatgtgtttgatgtgttggtcagccgaagacaaggttgccatcgtg |
23332924 |
T |
|
| Q |
101 |
tttcgccaaggaatatggtgtgcatgttgatgattatgtcatgttgcgtgatccaaacagaaacatgttcgaggtcaaggtccacgtgaaaaatggcaag |
200 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
23332923 |
tttcgccaaggaatatggtttgcatgttgatgattatgtcatgttgcgtgatccaaacagaaacatgttcaaggtcaaggtccacgtgaaaaatggcaag |
23332824 |
T |
|
| Q |
201 |
gtctatctgcgggatggttgggctgagctgaagggtttctataaggtagatcgtggtgcgtgggtcaccctgacttatgtacagccgaatcttctagata |
300 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
23332823 |
gtttatctgcgggatggttgggctgagctgaagggtttctataaggtagatcgtggtgcgtgggtcaccctgacgtatgtacagccgaatcttctagata |
23332724 |
T |
|
| Q |
301 |
tgactatcgcagagagatcaggagtcgaaatcaactatcctaacaaatttcttcctcccatgtcgaaaatgattgtccaacgtgagggtggatcggtcat |
400 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
23332723 |
tgactatcgcagagagatcaggagtcgaaatcaactatcctaacaaatttcttcctcccatgtcgaaaatgattgtcccacgtgagggtggatcggtcat |
23332624 |
T |
|
| Q |
401 |
gcgcttctatcgctcattcgtccacatat |
429 |
Q |
| |
|
|||||||||||||||||||||||| |||| |
|
|
| T |
23332623 |
gcgcttctatcgctcattcgtccatatat |
23332595 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 108 - 202
Target Start/End: Original strand, 10955074 - 10955166
Alignment:
| Q |
108 |
aaggaatatggtgtgcatgttgatgattatgtcatgttgcgtgatccaaacagaaacatgttcgaggtcaaggtccacgtgaaaaatggcaaggt |
202 |
Q |
| |
|
|||||||||||| |||| |||||||| |||||||| |||||||||| |||| |||||||||||||| ||||||||| ||| || |||||||| |
|
|
| T |
10955074 |
aaggaatatggtttgcacgttgatgactatgtcat--tgcgtgatcctaacaagaacatgttcgaggttaaggtccacaagaagaagggcaaggt |
10955166 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 424 - 466
Target Start/End: Complemental strand, 23322373 - 23322331
Alignment:
| Q |
424 |
acatatgcgtttggattttacaacgattgtgtttggtgatgtc |
466 |
Q |
| |
|
||||||||||||||| ||||||||| ||||||||||||||||| |
|
|
| T |
23322373 |
acatatgcgtttggagtttacaacgtttgtgtttggtgatgtc |
23322331 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 424 - 466
Target Start/End: Complemental strand, 23332540 - 23332498
Alignment:
| Q |
424 |
acatatgcgtttggattttacaacgattgtgtttggtgatgtc |
466 |
Q |
| |
|
||||||||||||||| ||||||||| ||||||||||||||||| |
|
|
| T |
23332540 |
acatatgcgtttggagtttacaacgtttgtgtttggtgatgtc |
23332498 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 32; Significance: 0.00000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 135 - 202
Target Start/End: Complemental strand, 2027759 - 2027692
Alignment:
| Q |
135 |
tatgtcatgttgcgtgatccaaacagaaacatgttcgaggtcaaggtccacgtgaaaaatggcaaggt |
202 |
Q |
| |
|
|||||||| |||||||||||||||| |||||||| ||||| || || ||| ||||||||||||||| |
|
|
| T |
2027759 |
tatgtcattttgcgtgatccaaacaagaacatgtttgaggttaaagttcacaagaaaaatggcaaggt |
2027692 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University