View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5659_1D_low_41 (Length: 204)
Name: NF5659_1D_low_41
Description: NF5659_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5659_1D_low_41 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 1 - 190
Target Start/End: Complemental strand, 52727159 - 52726970
Alignment:
| Q |
1 |
cttgtgcaacaagatgaatgctggtcatcaaagcccaacaaagaagaagtcttgggttggaaggttggtcaagtatggaacattcaatgttagaagtgga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52727159 |
cttgtgcaacaagatgaatgctggtcatcaaagcccaacaaagaagaagtcttgggttggaaggttggtcaagtatggaacattcaatgttagaagtgga |
52727060 |
T |
 |
| Q |
101 |
gctcgtgaagaacatgaggctttcatcctccccgagtataatcgttcaatcgatggacttgcttctccccgtcatatggggatgttttca |
190 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52727059 |
gctcgtgaagaacatgaggctttcatcctccccgagtataatcgttcaatcgatggacttgcttctccccgtcatatggggatgttttca |
52726970 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University