View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5659_2D_low_49 (Length: 236)
Name: NF5659_2D_low_49
Description: NF5659_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5659_2D_low_49 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 19 - 236
Target Start/End: Original strand, 46938454 - 46938683
Alignment:
| Q |
19 |
gccatgactatttgattattggttactgcaagttgcaaatatgtgttttaagactaacatagtttgcttgtttttgaaacatagatctgctgtacagtta |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46938454 |
gccatgactatttgattattggttactgcaagttgcaaatatgtgttttaagacttacatagtttgcttgtttttgaaacatagatctgctgtacagtta |
46938553 |
T |
 |
| Q |
119 |
gctatccattatttttctatctaacaattgatgc------------ttggtgggtcatacttgtactgcaagcaagtcattgttataagtttattcaatc |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46938554 |
gctatccattatttttctatctaacaattgatgcttgtttgtatgtttggtgggtcatacttgtactgcaagcaagtcattgttataagtttattcaatc |
46938653 |
T |
 |
| Q |
207 |
aacaacattgcactatttgaatggtcttac |
236 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
46938654 |
aacaacattgcactatttgaatggtcttac |
46938683 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University