View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5659_2D_low_57 (Length: 209)

Name: NF5659_2D_low_57
Description: NF5659_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5659_2D_low_57
NF5659_2D_low_57
[»] chr5 (1 HSPs)
chr5 (144-209)||(30901274-30901339)


Alignment Details
Target: chr5 (Bit Score: 62; Significance: 6e-27; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 62; E-Value: 6e-27
Query Start/End: Original strand, 144 - 209
Target Start/End: Original strand, 30901274 - 30901339
Alignment:
144 ctagtgtggaggaaagacaacatgctgagatgatgatggaaaatcaggcattgttatttctcatat 209  Q
    ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||    
30901274 ctagtgtggaggaaagacaacatgctgagatgatgatggaatatcaggcattgttatttctcatat 30901339  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University