View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5659_low_13 (Length: 240)
Name: NF5659_low_13
Description: NF5659
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5659_low_13 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 148; Significance: 3e-78; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 32 - 203
Target Start/End: Complemental strand, 27725142 - 27724971
Alignment:
| Q |
32 |
aataaatactaactgatttcagttatagaaagagcgttggttagttaagttagttaattaacgttttctgtcacatgaattgctcttgcaggcagtggtg |
131 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27725142 |
aataaatactaactgatttcagttatagaaagagcgttggttagttaagttagttaattaacgttttctgtcacatgaattgctcttgcaggcagtggtg |
27725043 |
T |
|
| Q |
132 |
ctgtttgctatgggtggttatggtacctatctgggttttcgcattcgttattccgatgacgtagtaagctat |
203 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||| | ||||||||| || ||| ||||| |
|
|
| T |
27725042 |
ctgtttgctatgggtggttacggtacctatctgggttttcgcattcgattttccgatgatgtggtacgctat |
27724971 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University