View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5659_low_7 (Length: 366)
Name: NF5659_low_7
Description: NF5659
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5659_low_7 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 297; Significance: 1e-167; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 297; E-Value: 1e-167
Query Start/End: Original strand, 20 - 344
Target Start/End: Complemental strand, 29525984 - 29525660
Alignment:
| Q |
20 |
atcactttgccttactaattgtgtgccttcccaatcaagcttggcagttaattgttttctgttagtgtggttgtaactaacttgtactttggctaatggc |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||| |
|
|
| T |
29525984 |
atcactttgccttactaattgtgtgccttcccaatcaagcttggcagttaattgttttctgttaatgtggttgtaactaacttctactttggctaatggc |
29525885 |
T |
|
| Q |
120 |
tatatataaagtcttaggagagaaaattattcattattaattttcatacctcgagtgctaagaatcagataagattaacagcaagaaatggtaagagtat |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
29525884 |
tatatataaagtcttaggagagaaaattattcattattaattttcataccttgagtgctaagaatcagataagattaaccgcaagaaatggtaagagtat |
29525785 |
T |
|
| Q |
220 |
tgattgagggattcatactgattcttaaaggagaatcaatgatggtgctctagatgtgtaaaagctcaattatatatctcagggatgtgggaaaacaatt |
319 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
29525784 |
tgattgagggattcatagtgattcttaaaggagaatcaatgatggtgctctagatgtgtaaaaactcaattatatatctcagggatgtgggaaaacaatt |
29525685 |
T |
|
| Q |
320 |
atctgaactttgttaacaatctctg |
344 |
Q |
| |
|
||||||| ||||||||||||||||| |
|
|
| T |
29525684 |
atctgaattttgttaacaatctctg |
29525660 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University