View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5659_low_9 (Length: 280)
Name: NF5659_low_9
Description: NF5659
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5659_low_9 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 1 - 262
Target Start/End: Original strand, 52727290 - 52727551
Alignment:
| Q |
1 |
tgtagctaacatcaaggtcagtgaaggacaagagaagtcctacagagtatggaatagaagtcaaatactgaaagttctgactcacgtttaggatttcaag |
100 |
Q |
| |
|
|||||||||||||||| ||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
52727290 |
tgtagctaacatcaagttcagtgagggacaagagaagtcctactgagtatggaatagaagtcaaatactgaaagttctgactcacatttaggatttcaag |
52727389 |
T |
 |
| Q |
101 |
gttgatgagattctcaagatcttccgggagagacctaagacagttcagtcttgcgtctaaaacctttagagatgtgaggtgagatgtggagcgtggaagg |
200 |
Q |
| |
|
||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52727390 |
gttgatgagattctcaagatcctccggaagagacctaagacagttcagtcttgcgtctaaaacctttagagatgtgaggtgagatgtggagcgtggaagg |
52727489 |
T |
 |
| Q |
201 |
aagatcagcttgttagagttgactgataannnnnnnaggtttattagctcataccctattgt |
262 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
52727490 |
aagatcagcttgttagagttgactgataatttttttaggtttattagctcataccctattgt |
52727551 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University