View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5661_low_6 (Length: 292)
Name: NF5661_low_6
Description: NF5661
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5661_low_6 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 85 - 278
Target Start/End: Original strand, 7542418 - 7542611
Alignment:
| Q |
85 |
gacaaagaagatggattggaaactgttcttgaaatacctatacctgaagaaatgttttcaaacatgggaagtaatgtgacattaagatggcaaaatatgt |
184 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7542418 |
gacaaagaagatggattggaaactgttcttgaaatacctatacctgaagaaatgttttcaaacatgggaagtaatgtgacattaagatggcaaaatatgt |
7542517 |
T |
|
| Q |
185 |
taacatggatgaaggctcaaactgaggataaattgtcttcccctacggtttcagcacgtttaaatgaacttcgatttttgctttaccttgttgg |
278 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7542518 |
taacatggatgaaggctcaaactgaggataaattgtcttcccctacggtttcagcacgtttaaatgaacttcgatttttgctttaccttgttgg |
7542611 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University