View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5663_high_6 (Length: 232)
Name: NF5663_high_6
Description: NF5663
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5663_high_6 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 114; Significance: 6e-58; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 114; E-Value: 6e-58
Query Start/End: Original strand, 1 - 134
Target Start/End: Complemental strand, 33855768 - 33855635
Alignment:
| Q |
1 |
tcacatgtgcatgtttgttctatcgttgttaaacatcttattagaattgtcgatgctacaaagtgagaaagataaatgtaatcacatgtgcgtatttatt |
100 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||| |||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33855768 |
tcacatgtgcgtgtttgttctatcgttgttaaacaccttattagaattgtcggtgctacaaaatgagaaagataaatgtaatcacatgtgcgtatttatt |
33855669 |
T |
 |
| Q |
101 |
agaacatgatgaattaaatttgtgtttatgtcaa |
134 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||| |
|
|
| T |
33855668 |
agaacatgatgaattaaatttgtgttcatgtcaa |
33855635 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 132 - 222
Target Start/End: Complemental strand, 33855255 - 33855165
Alignment:
| Q |
132 |
caacggcttttgctgttagaattaacttagttaggtgtataaactaatatttttgtatgcacatgccttgaatcattagtttgttgatgat |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33855255 |
caacggcttttgctgttagaattaacttagttaggtggttaaactaatatttttgtatgcacatgccttgaatcattagtttgttgatgat |
33855165 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University