View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5663_low_8 (Length: 238)
Name: NF5663_low_8
Description: NF5663
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5663_low_8 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 181; Significance: 6e-98; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 19 - 222
Target Start/End: Original strand, 47223766 - 47223967
Alignment:
| Q |
19 |
gttttagtgatatcatttgtgggtcagatttacaaacgacattaacgtttatcaagaataaggttctacctactcatcctatgctcatcttattgatact |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47223766 |
gttttagtgatatcatttgtgggtcagatttacaaacgacattaatgtttatcaagaataaggttctacctactcatcctatgctcatcttattgatact |
47223865 |
T |
|
| Q |
119 |
attcgttattttatgccgagagattgaaatgctgtgttgagtcacataatcatgccttgcatgaagggatctcttttgtagattgacttgttaaattgga |
218 |
Q |
| |
|
| ||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47223866 |
aatcgttattttatgccgagagattgaaatgttgtgttgagt--cataatcatgccttgcatgaagggatctcttttgtagattgacttgttaaattgga |
47223963 |
T |
|
| Q |
219 |
tgct |
222 |
Q |
| |
|
|||| |
|
|
| T |
47223964 |
tgct |
47223967 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University