View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5665_high_12 (Length: 315)
Name: NF5665_high_12
Description: NF5665
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5665_high_12 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 275; Significance: 1e-154; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 275; E-Value: 1e-154
Query Start/End: Original strand, 19 - 305
Target Start/End: Original strand, 32525519 - 32525805
Alignment:
| Q |
19 |
cacttaccatccgtgatactgttagttacaatgccatgatcaccgcgtattctcatggtaacgatggacacgctgcgcttaatctcttcgttcaaatgaa |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32525519 |
cacttaccatccgtgatactgttagttacaatgccatgatcactgcgtattctcatggtaacgatggacacgctgcgcttaatctcttcgttcaaatgaa |
32525618 |
T |
 |
| Q |
119 |
aagatacggctttttacctgatccgtttacgttctccagcgtgctttctgctctatcattgatagcggacgaagagcggcattgtcaaatgctacattgt |
218 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32525619 |
aagatacggctttttacctgatccatttacgttctccagcgtgctttctgctctatcattgatagcggacgaagagcggcattgtcaaatgctacattgt |
32525718 |
T |
 |
| Q |
219 |
gaggttatcaaattgggaacattgttgataccatctgttacgaatgcacttttgagttgctacgtttgttgtgcttcttcgcctttg |
305 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
32525719 |
gaggttatcaaattgggaacattgttgataccatctgttacgaatgcacttttaagttgctacgtttgttgtgcttcttcgcctttg |
32525805 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University