View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5665_high_8 (Length: 356)
Name: NF5665_high_8
Description: NF5665
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5665_high_8 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 77; Significance: 1e-35; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 232 - 308
Target Start/End: Original strand, 39231232 - 39231308
Alignment:
| Q |
232 |
gacagttcctgtttggcggatagtacttcgattcgttctgaatgtgctctctgtaacaccaagtgctctcaaaaagg |
308 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39231232 |
gacagttcctgtttggcggatagtacttcgattcgttctgaatgtgctctctgtaacaccaagtgctctcaaaaagg |
39231308 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 75 - 157
Target Start/End: Original strand, 39231074 - 39231156
Alignment:
| Q |
75 |
gttggatcttgaagcttgaacttgttcaagaaaccggttttgttgccatgcaatcatttgttctgcaggttcgttaattcttc |
157 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39231074 |
gttggatcttgtagcttgaacttgttcaagaaaccggttttgttaccatgcaatcatttgttctgcaggttcgttaattcttc |
39231156 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University