View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5665_low_10 (Length: 356)

Name: NF5665_low_10
Description: NF5665
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5665_low_10
NF5665_low_10
[»] chr7 (2 HSPs)
chr7 (232-308)||(39231232-39231308)
chr7 (75-157)||(39231074-39231156)


Alignment Details
Target: chr7 (Bit Score: 77; Significance: 1e-35; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 232 - 308
Target Start/End: Original strand, 39231232 - 39231308
Alignment:
232 gacagttcctgtttggcggatagtacttcgattcgttctgaatgtgctctctgtaacaccaagtgctctcaaaaagg 308  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
39231232 gacagttcctgtttggcggatagtacttcgattcgttctgaatgtgctctctgtaacaccaagtgctctcaaaaagg 39231308  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 75 - 157
Target Start/End: Original strand, 39231074 - 39231156
Alignment:
75 gttggatcttgaagcttgaacttgttcaagaaaccggttttgttgccatgcaatcatttgttctgcaggttcgttaattcttc 157  Q
    ||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||    
39231074 gttggatcttgtagcttgaacttgttcaagaaaccggttttgttaccatgcaatcatttgttctgcaggttcgttaattcttc 39231156  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University