View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5665_low_11 (Length: 354)
Name: NF5665_low_11
Description: NF5665
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5665_low_11 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 191; Significance: 1e-103; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 191; E-Value: 1e-103
Query Start/End: Original strand, 24 - 214
Target Start/End: Complemental strand, 32611806 - 32611616
Alignment:
| Q |
24 |
gacctcttctttagggttccgattcccaatgtactactcgacgccgacttccctcccaccgttcgatcattcaccgatcacatcgaagtcaaattgcttc |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32611806 |
gacctcttctttagggttccgattcccaatgtactactcgacgccgacttccctcccaccgttcgatcattcaccgatcacatcgaagtcaaattgcttc |
32611707 |
T |
|
| Q |
124 |
tcttacttcccgtcgaccaccctgttctctccgcacttcatcaaacctcgccgcttcctcaacctttctcaatggattatggtaactgttg |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32611706 |
tcttacttcccgtcgaccaccctgttctctccgcacttcatcaaacctcgccgcttcctcaacctttctcaatggattatggtaactgttg |
32611616 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 288 - 336
Target Start/End: Complemental strand, 32611542 - 32611494
Alignment:
| Q |
288 |
agatgtggataaattatcttctgctggagaagttgaatttgtttgtaga |
336 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32611542 |
agatgtggataaattatcttctgctggagaagttgaatttgtttgtaga |
32611494 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University