View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5665_low_21 (Length: 247)
Name: NF5665_low_21
Description: NF5665
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5665_low_21 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 233; Significance: 1e-129; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 15 - 247
Target Start/End: Original strand, 5064202 - 5064434
Alignment:
| Q |
15 |
aattacttgttcagtttgtaaagttattgatatgtgatggtgtttgtcagggaaatggccagtgcaggtttatctggaataatttcctccggaattggaa |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5064202 |
aattacttgttcagtttgtaaagttattgatatgtgatggtgtttgtcagggaaatggccagtgcaggtttatctggaataatttcctccggaattggaa |
5064301 |
T |
 |
| Q |
115 |
atttgagtcacctccgaacattgtgagttgcaatctcaggactttattcacattatccagatttacttatcactgaccttttccgttgtattatcttagg |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5064302 |
atttgagtcacctccgaacattgtgagttgcaatctcaggactttattcacattatccagatttacttatcactgaccttttccgttgtattatcttagg |
5064401 |
T |
 |
| Q |
215 |
ctattgcagaacaatcagttatctggtcctatc |
247 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
5064402 |
ctattgcagaacaatcagttatctggtcctatc |
5064434 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University