View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5665_low_26 (Length: 234)
Name: NF5665_low_26
Description: NF5665
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5665_low_26 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 1 - 219
Target Start/End: Complemental strand, 34568719 - 34568501
Alignment:
| Q |
1 |
cttaggagctctaagtttcagaaaaggatcaacaggaacataacatccaagtttaaaattcgactggaagaaatatttgaactactgcagaaagagattt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34568719 |
cttaggagctctaagtttcagaaaaggatcaataggaacataacatccaagtttaaaattcgactggaagaaatatttgaactactgcagaaagagattt |
34568620 |
T |
|
| Q |
101 |
tattgatgtctcataaatcgaatgtgtaaaggataaatgtatacgggttaattcttgttatttgatttggtaatgtataatgtcggagctgcttgttttg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||| |||||||||||||||| |
|
|
| T |
34568619 |
tattgatgtctcataaatcgaatgtgtaaaggataaatgtatacgggttaatacttgttatttgatttggtcatgtataatgtgggagctgcttgttttg |
34568520 |
T |
|
| Q |
201 |
cttctctgatgacacattt |
219 |
Q |
| |
|
|||||||||||| |||||| |
|
|
| T |
34568519 |
cttctctgatgaaacattt |
34568501 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University