View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5665_low_28 (Length: 221)
Name: NF5665_low_28
Description: NF5665
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5665_low_28 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 184; Significance: 1e-100; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 184; E-Value: 1e-100
Query Start/End: Original strand, 30 - 221
Target Start/End: Complemental strand, 36142810 - 36142619
Alignment:
| Q |
30 |
caaaaatccatggcagttatatcaagccacaacctattctccactttcactcgcttgaacagctcatcaagaatcaacccccactcacaaacaaccaaca |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
36142810 |
caaaaatccatggcagttatatcaagccacaacctattctccactttcactcgcttcaacagctcatcaagaatcaatccccactcacaaacaaccaaca |
36142711 |
T |
|
| Q |
130 |
gcgcaagattgattcgaattcgatgcagtggtgatttgagcacatgtgctacgaacacggttgagaatcagcagagagtgaaactgagtaac |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36142710 |
gcgcaagattgattcgaattcgatgcagtggtgatttgagcacatgtgctacgaacacggttgagaatcagcagagagtgaaactgagtaac |
36142619 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University