View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5665_low_30 (Length: 212)
Name: NF5665_low_30
Description: NF5665
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5665_low_30 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 35 - 197
Target Start/End: Original strand, 52402650 - 52402811
Alignment:
| Q |
35 |
atcatgaaataatagtaacacaactacaatcaaacgccaattcctagcataaatttgacaaacacgctctgaccaacatatactgcattgctcaagaatc |
134 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52402650 |
atcatgaaataatagtaacacaactacaatcaaacgccaattcctagcataaatttgacaaacacgctctgaccaacatatactgcattgctcaagaatc |
52402749 |
T |
|
| Q |
135 |
tgaatactgtaatattgctcgatgtctcttaagatcttgatatcatccctacaaaccatgatt |
197 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||| ||| |||||||||||| |
|
|
| T |
52402750 |
tgaatactgtaatattgctcgatgtctcttaagatctcgatatcat-cctgcaaaccatgatt |
52402811 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University